The role of the annealing process in glass processing is to... | Filo

SOLVED: An AISI 304 stainless steel sheet is going through an annealing process inside an electrically heated oven. The ambient air inside the oven is 600°C, while the surrounding surfaces of the oven are at a uniform temperature of 750°C. If the emissivity of the stainless steel sheet is 0.40 and the average convection heat transfer coefficient is 10 W/m²·K, determine the temperature of the stainless steel sheet.

SOLVED: In your own words describe the following heat treatmentprocedures for steels and, for each, the intended finalmicrostructure: full annealing, normalizing, quenching, andtempering.What is the purpose of a spheroidizing heat treatment? On whatclasses of alloys is it normally used?Briefly explain the difference between hardness andhardenability.

The World's First And Only Smart Annealer

a). Explain the two types of annealing process in the heat treatment of metals. b). Explain the stages in a heat treatment process.

SOLVED: The annealing temperature of a DNA duplex is given by the formula:Tm = 4(# of G-C base pairs) 2(# of A-T base pairs). Calculate the annealing temperature for the following primers:5'ATGCCTATAGAATCGTC3'5'CGATAGCTAGCTAGCTCCTGCATCG3'5'ATCGCCGTATATTCGTATAGGCGCGAT3'5'ACTACTCCGATGCCTAATGC3'5'GCATCGCTAGCTCCGATATAT3'What advantage is there in adding an excess of primer when you do PCR?How many copies of a gene are produced after 30 cycles of PCR amplification if you start with 320 molecules of